terrence2x terrence2x
  • 24-06-2019
  • Mathematics
contestada

Graph the linear equation. Find three
points that solve the equation, then plot
on the graph.
2x – 3y = -6

Respuesta :

hienh4517 hienh4517
  • 24-06-2019
-3y = -2x -6

Y= 2/3x + 2


When x= 3
Y= 2/3(3) + 2
Y= 2+2 = 4

(3,4)


When x= 6
Y=2/3(6)+2
Y= 4+2 = 6

(6,6)


When x= 12
Y= 2/3(12) + 2
Y= 8+2=10

(12,10)
Answer Link
lovelylashesnthreadi lovelylashesnthreadi
  • 21-06-2020

Answer:

3,4

6,6

9,8

Step-by-step explanation:

Answer Link

Otras preguntas

How many roots of f(x) are rational numbers? 1 2 4 6
A dwarf sea horse swims at a rate of 50.68 feet per hour. Convert this speed to inches per minute. The speed is Inches per minute.
How many major glands are in our body? (number)
Use this diagram of an animal cell to answer the question Where does the first stage of cellular respiration occur?
PLZ HELP!!!! Will give brainliest Calculate the molarity of a solution prepared by dissolving 89 g of KNO. in 0.525 L of water. Show your work
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
What is the upper quartile of the numbers: 12, 6, 10, 20, 4, 8, 7
How does Proctor thwart Danforth in the scene from The Crucible? What does Proctor accomplish for himself in the process? Support your response with text PLEASE
I need help asap if you would. A right triangle has a hypotenuse of 25.5 inches abd a leg of 12 inches. What is the lenghth of the other leg?
Which percent represents the decimal 0.0125? A. 0.125% B.1.25 C. 12.5% D. 125%