helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

How do I solve this and write it in scientific notation?

Recall the formula of glucose is c 6 h 12 o 6 . how many carbon, oxygen, and hydrogen atoms will you need for three glucose molecules

68 more than quotient of an unknown number and 54 is 72 what is the equation for the statement shown?

What is a metamorphic rock?

If you drive for 2 hours, at 60 miles per hour, you will have traveled 120 miles. this is a very common type of calculation, involving three quantities: distanc

Sid files a suit against tina. before going to trial, the parties, with their attorneys, meet to try to resolve their dispute. a third party helps them to reach

Kendra and her horse completed the barrel racing course in 15.839 seconds. What is this number rounded to the nearest tenth? :explain how you decided

bill's organization expects 50% of profits to be generated by products that did not exist five years ago. what is the nature of the programs that the organiz

Which natural attraction in USA are in greatest need of conservation?

A bird is flying due east. Its distance from a tall building is given by x(t)=30.0m+(11.7m/s)t−(0.0450m/s3)t3. A) What is the instantaneous velocity of the bir