mbedzipfano17 mbedzipfano17

23-05-2021
Chemistry

contestada

How many total number of hydrogen atoms present in CH4?

Respuesta :

emanshahzadi929 emanshahzadi929

23-05-2021

Answer:

4 Hydrogen atoms

Answer Link

moniquesmithx moniquesmithx

23-05-2021

Well 1 mole of CH4 contains 24. 088×1023 hydrogen atom.

Answer Link

Otras preguntas

how is burning methane similar to burning magnesium?

Read the sentence. Everyone knows that there is no water on Mars. What type of propaganda technique does the sentence use? A.) stereotyping B.) bandwa

Which plot events occur in “The Market-Place”? Check the two best choices. Hester exits the jail with her infant. Women in the crowd cry out for Hester’s rele

make a story using these words. Affable Haughtiness Halcyon Lethargic aspire

imagine you live only one mile from work and you decide to walk.if you walk four milesb per hour how long will it take you to walk one mile?

Time Remaining Goblet cells, salivary glands, sweat glands, oil glands, liver, pancreas, and lacrimal glands are all structures of

How is the process of stratigraphic correlation carried out? a. by dating through the use of a chronometric method b. by matching stratigraphy from known sites

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

¿Cuál de los siguientes mandatos negativos no está escrito correctamente? No pienses en eso. No te pongas los zapatos. No saces tu libro.

Which trait is prominent in acts 1 & 2 of Macbeth