kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Finding missing sides- similar triangles Algebraic practice )

what should we do to increase literacy in nepal

-2x(-3x +2)- (x+2)2 giúp tôi với!

How are regional intergovernmental organizations (IGOs) different from organizations like the United Nations? A. They are able to pass laws that must be obeyed

A60.cm high cylinder with 14 cm its diameter is cut vertically into two equal halves. What is the volume of a half part?

A greater stopping distance especially in emergency situations

Please help again please and thank you :)

7 1/3 x 7/11 simplify the answer completely and change to a mixed number

hellooo merry christmas ! can someone please help mee? ik its a lot but even just a little help would be very mich appreciated :))

9 Ammonia is manufactured from nitrogen and hydrogen by the Haber process. N2(g) + 3H2(g)2NH3(g) What is the percentage yield when 60 kg of ammonia is produced